Informacija

Koja strana spirale DNK se koristi za opisivanje SNP -ova?

Koja strana spirale DNK se koristi za opisivanje SNP -ova?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

U genetskim istraživanjima često nailazim na reference na polimorfizme s jednim nukleotidom (SNP). Primjer jers3184504 (C; T). Koliko ja razumijem: U ovom slučajurs3184504odnosi se na određenu točku u genomu DNA i (budući da se ova javlja u kromosomu koji nije spolni čovjek) označava nukleotide u toj točki u svakoj kopiji tog kromosoma.

No, kako odrediti na koji se lanac spirale DNK odnosi? Postoji li konvencija? Ili je pramen naveden u SNP referenci (u ovom slučajurs3184504)?

Ako je jedan pramenC; Ttada će suprotna nit bitiG; A... ali u kontekstu dotičnog gena pretpostavljam da je važno koji se niz spominje u SNP -u. Na primjer, ako kôd slijedi ovaj SNP na kromosomu u kojemrs3184504imaCje:

CTCGA… GAGCT…

ovo je drugačiji genotip od SNP -a koji označava aCs druge strane:

GTCGA… CAGCT…

Dakle, opis SNP -a ima smisla samo ako također označava niti, zar ne? Ako je tako, kako to čini deskriptor SNP -a?


@WYSIWYG je točan, ali s obzirom na kratkoću njegovog odgovora (i drugog odgovora koji mu je kontradiktoran) dajem poglavlje i stih.

Definicija RefSNP referentni broj NCBI daje kao:

"Referentni broj SNP ID -a ili" rs "ID identifikacijska je oznaka koju NCBI dodjeljuje grupi (ili grupi) SNP -ova koji se preslikavaju na isto mjesto."

Važno je shvatiti da ovaj broj nema nikakve veze s numeriranjem DNK sekvence:

"ID broj rs ili oznaka rs dodjeljuje se nakon slanja."

Da biste pronašli informacije o položaju SNP -a s njegovog rs broja, možete pretražiti NCBI dbSNP. U slučaju rs1384504, prvih nekoliko redaka prvog unosa u rezultatima pretraživanja je:

Vrsta varijante: SNV alele: T> A, C, G kromosom: 12: 111446804 (GRCh38)

To ukazuje da je SNP na poziciji 111446804 na kromosomu 12, koji ima T u referentnom genomu, a to leži u genu označenom SH2B3. (To možete pronaći putem veza na ovoj stranici.)

Na ovoj se stranici može vidjeti da se orijentacija ovog gena podudara s orijentacijom referentnog kromosoma. Međutim, obližnji gen, PPP1CC, je u suprotnoj orijentaciji i sadrži SNP rs367543175 C/T. Početak unosa za to je

Vrsta varijante: SNV alele: C> T kromosom: 12: 110720185 (GRCh38)

... što ukazuje da je SNP na položaju 110720185 na kromosomu 12, koji ima C u referentnom genomu, tj. protuosjećanje lanac ovog gena.

I, naravno, većina ljudskih SNP-ova leži izvan gena, pa se koncept osjetila i lanca osjetila ne primjenjuje.

Zaključak

Da bismo saznali odgovara li referentna baza u oznaci za SNP koji leži u kodirajućoj regiji gena osjetilnoj ili protuosjetilnoj niti tog gena, potrebno je pristupiti dokumentaciji za taj SNP. Ova informacija je ne utjelovljene u podacima o alelama pridodane referentnom ID broju SNP -a.


Opisano je s obzirom na referentni slijed. Pogledajte opis formata VCF.


DNK ima "osjetilni" lanac i antisens lanac. Osjetna nit za taj gen je ono do čega vam je stalo kada raspravljate o SNP -ima u tom genu, jer se on transkribira (i, kao rezultat toga, onaj koji utječe na organizam). Za više informacija o osjetilnim i antisense nitima, postoje neki prilično dobri objašnjeni youtube videi i unosi u Wikipediji.


Popravak izrezivanja nukleotida

Popravak izrezivanja nukleotida je mehanizam popravka DNK. [2] Do oštećenja DNA dolazi stalno zbog kemikalija (npr. Interkalirajućih sredstava), zračenja i drugih mutagena. Postoje tri načina popravljanja ekscizije za popravljanje jednolančanog oštećenja DNA: Nukleotidni ekscizijski popravak (NER), bazni ekscizijski popravak (BER) i popravak neusklađenosti DNA (MMR). Dok BER put može prepoznati specifične ne-glomazne lezije u DNK, može ispraviti samo oštećene baze koje su uklonjene specifičnim glikozilazama. Slično, MMR put cilja samo na neusklađene osnovne parove Watson-Crick.

Popravak nukleotidnog izrezivanja (NER) posebno je važan mehanizam izrezivanja koji uklanja oštećenja DNA uzrokovana ultraljubičastim svjetlom (UV). Oštećenje UV DNK rezultira glomaznim DNK aduktima - ti su adukti uglavnom dimini timina i 6,4 -fotoprodukti. Prepoznavanje oštećenja dovodi do uklanjanja kratkog jednolančanog segmenta DNA koji sadrži leziju. Neoštećena jednolančana DNA ostaje i DNA polimeraza koristi je kao predložak za sintezu kratkog komplementarnog niza. Konačno podvezivanje kako bi se dovršio NER i formirao dvolančana DNA provodi DNA ligaza. NER se može podijeliti na dva potputa: globalni genomski NER (GG-NER ili GGR) i transkripcijski povezani NER (TC-NER ili TCR). Dva se podputa razlikuju u načinu na koji prepoznaju oštećenje DNA, ali dijele isti proces za rezanje, popravak i podvezivanje lezija.

O važnosti NER-a svjedoče teške ljudske bolesti koje su posljedica urođenih genetskih mutacija proteina NER. Xeroderma pigmentosum i Cockayneov sindrom dva su primjera bolesti povezanih s NER -om.


Parovi baze

Dopuštene su samo određene vrste uparivanja baze. Na primjer, određeni purin može se upariti samo s određenim pirimidinom. To znači par adenina s timinom, a gvanin s citozinom. Ovo je poznato kao osnovno komplementarno pravilo jer su niti DNK međusobno komplementarne. Ako je slijed jedne niti AATTGGCC, komplementarna nit će imati sekvencu TTAACCGG.

Antiparalelne nitiU dvolančanoj molekuli DNK, dvije niti se protežu međusobno paralelno, tako da jedna niti prolaze 5 ′ do 3 ′, a druga 3 ′ do 5 ′. Okosnica fosfata nalazi se s vanjske strane, a baze su u sredini. Adenin tvori vodikove veze (ili parove baza) s timinom, a parovi baza gvanina s citozinom.


Za više informacija o SNP -ovima:

Audio definicija SNP -a dostupna je u Govornom rječniku genetskih pojmova Nacionalnog instituta za istraživanje ljudskog genoma.

Kako znanstvenici lociraju SNP -ove u genomu objašnjava Centar za učenje genetičkih znanosti Sveučilišta Utah.

Za ljude koje zanima više tehničkih podataka dostupno je nekoliko baza poznatih SNP -ova:


Kako se DNK sekvence koriste za stvaranje proteina?

DNK upute se koriste za stvaranje bjelančevina u procesu u dva koraka. Prvo, enzimi čitaju informacije u molekuli DNA i prepisuju ih u posredničku molekulu zvanu glasnička ribonukleinska kiselina ili mRNA.

Zatim se informacije sadržane u molekuli mRNA prevode u "jezik" aminokiselina, koje su građevni blokovi proteina. Ovaj jezik govori strojevima za proizvodnju bjelančevina u stanicama točan redoslijed povezivanja aminokiselina u proizvodnju određenog proteina. Ovo je veliki zadatak jer postoji 20 vrsta aminokiselina, koje se mogu svrstati u mnogo različitih redova kako bi nastale brojne proteine.

DNK upute se koriste za stvaranje bjelančevina u procesu u dva koraka. Prvo, enzimi čitaju informacije u molekuli DNA i prepisuju ih u posredničku molekulu zvanu glasnička ribonukleinska kiselina ili mRNA.

Zatim se informacije sadržane u molekuli mRNA prevode u "jezik" aminokiselina, koje su građevni blokovi proteina. Ovaj jezik govori strojevima za proizvodnju bjelančevina u stanicama točan redoslijed povezivanja aminokiselina u proizvodnju određenog proteina. Ovo je veliki zadatak jer postoji 20 vrsta aminokiselina, koje se mogu svrstati u mnogo različitih redova kako bi nastale brojne proteine.


Jedno od pitanja koje dobivam prilično redovito je razlika između STR i SNP -a.

Općenito, ono što ljudi zaista žele razumjeti je razlika između proizvoda, a osnovni odgovor je zaista sve što žele. Objašnjavam da je STR ili kratko tandem ponavljanje drugačija vrsta mutacije od SNP -a ili polimorfizma s jednim nukleotidom. STR su genetski korisni za određivanje s kim se slažete u nedavnom vremenskom okviru, recimo, u zadnjih 500 -ak godina, a SNP -ovi definiraju haplogrupe koje sežu daleko dalje u prošlost. Nadalje, SNP -ovi se smatraju "jednom u životu", ili možda bolje rečeno, "jednom u životu čovječanstva", poznati kao UEP, jedinstveni polimorfizam događaja, gdje se STR -ovi događaju "cijelo vrijeme", u svakoj haplogrupi. Zapravo, to je razlog zašto možete provjeriti iste STR markere u svakoj haplogrupi - one markere koje svi znamo i volimo.

Ovo je dugo bilo prilično dobro objašnjenje, ali kako se tehnologija sekvenciranja poboljšala i postali dostupni novi testovi, poput testova Full Y i Big Y, vrlo brzo se otkrivaju nove mutacije koje zamagljuju granicu između vremenskih okvira koristi se za odvajanje ovih vrsta testova. Zapravo, sada se vremenski preklapaju pa SNP -ovi u nekim slučajevima postaju genealoški korisni. To također znači da su ovi novootkriveni obiteljski SNP -ovi relativno novi, što znači da su se dogodili samo između sadašnje generacije i prije 1000 godina, pa ne bismo trebali očekivati ​​da ćemo pronaći veliki broj ovih novorazvijenih mutacija u populaciji. Na primjer, ako se SNP koji je definirao haplogrupu R1b1a2, M269, dogodio prije 15.000 godina u jednom čovjeku, njegovi potomci imali su 15.000 godina da se razmnože i proslijede svoj M269 niz liniju (e), što su vrlo uspješno učinili otprilike polovicu Europe je ili M269 ili podrazred.

Svaka podklada ima vlastiti SNP. Zapravo, svaka podklada definirana je posebnim SNP -om koji čini vlastitu granu ljudskog Y haplotree.

Ali kako SNP ili STR doista izgledaju, mislim, u sirovim podacima? Kako znate da vidite jedno ili drugo?

Kao bejzbol - 4 baze

Najmanje jedinice DNK sastoje se od 4 bazična nukleotida, riječi DNK, koje su predstavljene sljedećim slovima:

A = Adenin
C = citozin
G = Guanin
T = timin

Ti se nukleotidi kombiniraju u parovima i tvore ljestvičaste prečke DNK, prikazane desno koje povezuju okosnice spirale. T se obično kombinira s A i C, obično se kombinira s G, dosežući između kralježnice dvostruke spirale kako bi se povezao sa svojim popratnim proteinom u središtu.

Ne morate se sjećati riječi, pa čak ni slova, samo zapamtite da tražimo podudarnosti uzoraka segmenata DNK.

Točkaste mutacije

Vaš DNK, kada je predstavljen na papiru, izgleda kao niz perlica u kojem postoje 4 vrste perlica, od kojih svaka predstavlja jedan od gore navedenih nukleotida. Jedan segment vaše DNK mogao bi izgledati ovako:

Ako ovako izgleda standardni ili referentni slijed za vaš haplotip (vaši osobni rezultati DNK) ili vašu obiteljsku haplogrupu (klan predaka), tada bi se mutacija definirala kao svaka promjena, dodavanje ili brisanje. Promjena bi bila ako bi se prvo gore navedeno A promijenilo u T ili G ili C kao u donjem primjeru:

Brisanje bi se primijetilo da vodeći A jednostavno nestane.

Dodatak bi, naravno, bio da se u zrnce na to mjesto umetne nova kuglica.

Sve gore navedene promjene uključuju samo jedno mjesto. Sve su to poznate kao točkaste mutacije jer se pojavljuju u jednoj jedinoj točki.

Točkasta mutacija može ili ne mora biti SNP. Genetičari SNP definiraju kao točkastu mutaciju koja se nalazi u više od 1% populacije. Ovo bi vam odmah trebalo reći da kada kažemo "otkrili smo novi SNP", doista pogrešno primjenjujemo taj izraz, jer sve dok ne utvrdimo da je učestalost koja se nalazi u populaciji iznad praga od 1% , doista nije SNP, ali se i dalje smatra točkastom mutacijom ili binarnim polimorfizmom.

Danas, kada se otkriju SNPS ili točkaste mutacije, smatraju se "privatnim mutacijama" ili "obiteljskim mutacijama". Već neko vrijeme postoji zastrašenost oko toga kako se nositi s ovakvim situacijama. ISOGG je postavio svoje kriterije na svojoj web stranici. Trenutno imaju najopsežnije stablo, ali zasigurno im je posve određen posao s nadolazećim tsunamijem novog SNPS -a koji će biti otkriven pomoću ovih testova sljedeće generacije, od kojih su stotine trenutno u procesu.

STR ili kratko ponavljanje u tandemu analogno je genetskom zamuckivanju ili zaglavljivanju kopirnog stroja. U istoj situaciji kao gore, koristeći istu bazu za usporedbu, vidimo skupinu umetnutih nukleotida koji su svi međusobno duplikati.

U ovom slučaju imamo kratki tandem ponavljanje duljine 4 segmenta što znači da se CT umetne 4 puta. Za prijevod, ako je ovo marker DYS marker 390, imate vrijednost 5, što znači 5 ponavljanja CT -a.

Tako da sam debeo i zadovoljan s tim sada već godinama, više od desetljeća.

Ključ za majmune

"L69/L159 polimorfizam je u biti SNP/STR oksimoron."

Koliko ja znam, to je nemoguće - jedna vrsta mutacije isključuje drugu. Guglao sam o ovoj temi i nisam našao ništa, niti sam našao dodatnu raspravu o L69, osim ove.

Moja prva reakcija na ovo bila je "to je nemoguće", nakon čega je uslijedio "Krvavi pakao", a moja sljedeća reakcija je bila pronaći nekoga tko zna.

Obratio sam se dr. Davidu Mittelmanu, genetičaru i glavnom znanstvenom direktoru u Gene by Gene, matičnoj tvrtki DNA obiteljskog stabla. Pitao sam ga o SNP/STR oksimoronu i rekao je:

"Ovo je nemoguće. Ne postoji SNP/STR. ”

Vau! Moram reći, laknulo mi je. Mislio sam da sam tamo na trenutak izgubio razum.

Pitao sam ga što se zapravo događa u ovom nizu, a on mi je odgovorio: "Ovo bi bila složena varijanta - kada se događa više stvari odjednom."

E sad, razumijem. Imam djecu i unuke - potpuno razumijem više stvari koje se događaju odjednom. Razdvojimo ovaj primjer i pogledajmo što se doista događa.

HUGO je referentni standard, pa krenimo od toga kao osnovu za usporedbu.

U varijanti L69 imamo sljedeći slijed.

U ovom slijedu vidimo dvije različite stvari. Prvo, imamo brisanje dva G -a, i drugo, imamo umetanje jednog dodatnog TG -a. Prema dr. Mittelmanu, oba ova događaja su STR -ovi, višestruko umetanje ili brisanje, a niti točkaste mutacije ili SNP -ovi, pa niti jedan od njih ne bi trebao imati nazive SNP -a, oni bi trebali imati nazive tipa STR.

Pogledajmo varijantu L159.

U ovom slučaju imamo umetanje GG -a i zatim brisanje TG -a.

U oba slučaja, L69 i L159, stvarna duljina DNK sekvence ostaje ista kao referentna, ali je sadržaj različit. Obojici su uklonjena 2 nukleotida, a dodana 2.

Dobra vijest je da kao potrošač to zapravo ne morate znati, ne na ovoj razini. Još je bolja vijest da se s novim otkrićima, bilo da se radi o STR -ovima ili SNP -ovima, na lisnatom kraju grane, često preklapaju sa SNP -ovima koji postaju genealoški mnogo korisniji. U prošlosti, ako ste gledali vremensku liniju genetskih mutacija, imali ste STR -ove koji su pokrivali struju do 1000 godina, a zatim ništa, pa počevši od 5000 ili 10 000 godina, imate SNP -ove koji su definirali haplogrupu.

Taj se jaz stalno smanjivao, a danas često nema praznina, provalija je nestala, a mi svakodnevno otkrivamo svježe izležene nedavno nastale SNP-ove.

Brzo se približava dan kada ćete htjeti cijeli Y niz, ne da biste dodatno definirali svoju haplogrupu, već da biste dodatno ocrtali svoje rodoslovne linije. Za to ćete imati dva alata, oba SNP -a i STR -a, a ne samo jedan.

Primam mali doprinos kad kliknete na neke od veza do dobavljača u mojim člancima. Ovo NE povećava cijenu koju plaćate, ali mi pomaže da svjetla i ovaj informativni blog budu besplatni za sve. Molimo kliknite na veze u člancima ili na prodavatelje u nastavku ako kupujete proizvode ili DNK testiranje.


Kako je DNK raspoređen u stanici

DNK je radna molekula koja se mora replicirati kad je stanica spremna za diobu i mora se "čitati" kako bi se proizvele molekule, poput bjelančevina, za obavljanje funkcija stanice. Iz tog razloga, DNK je zaštićena i zapakirana na vrlo specifične načine. Osim toga, molekule DNA mogu biti vrlo dugačke. Rastegnute od kraja do kraja, molekule DNA u jednoj ljudskoj stanici došle bi do a duljine oko 2 metra. Stoga se DNK stanice mora pakirati na vrlo uređen način kako bi stala i funkcionirala unutar strukture (stanice) koja nije vidljiva golim okom. Kromosomi prokariota su po mnogim svojim značajkama mnogo jednostavniji od onih eukariota (slika 9.6). Većina prokariota sadrži jedan kružni kromosom koji se nalazi u području citoplazme koje se naziva nukleoid.

Slika 9.6 Eukariot sadrži dobro definiranu jezgru, dok u prokariota kromosom leži u citoplazmi u području koje se naziva nukleoid.

Veličina genoma u jednom od najbolje proučavanih prokariota, Escherichia coli, iznosi 4,6 milijuna parova baza, što bi se produžilo na udaljenost od oko 1,6 mm ako se ispruži. Pa kako se to uklapa u malu bakterijsku stanicu? DNK je uvijena izvan dvostruke spirale u takozvanom supermotanju. Poznato je da su neki proteini uključeni u supermotanje, drugi proteini i enzimi pomažu u održavanju super namotane strukture.

Eukarioti, čiji se kromosomi svaki sastoje od linearne molekule DNA, koriste drugačiju strategiju pakiranja kako bi uklopili svoju DNK u jezgru. Na najosnovnijoj razini, DNK je omotana oko bjelančevina poznatih kao histoni i tvori strukture nazvane nukleosomi. DNK je čvrsto omotana oko jezgre histona. Ovaj nukleosom je povezan sa sljedećim kratkim lancem DNA bez histona. Ovo je također poznato kao struktura "perle na nizu", nukleosomi su "kuglice", a kratke duljine DNA između njih su "niz". Nukleosomi, s DNK omotanom oko njih, kompaktno se naslažu jedan na drugi i tvore vlakno širine 30 nm. Ovo vlakno se dalje umotava u deblju i kompaktniju strukturu. U metafaznoj fazi mitoze, kada su kromosomi poredani u središtu stanice, kromosomi su najviše zbijeni. Širine su približno 700 nm, a nalaze se zajedno s proteinima skele.

U međufazi, fazi staničnog ciklusa između mitoza u kojoj se kromosomi dekondenziraju, eukariotski kromosomi imaju dvije različite regije koje se mogu razlikovati bojenjem. Postoji dobro zapakirana regija koja tamno mrlja, i manje gusta regija. Tamno obojena područja obično sadrže gene koji nisu aktivni, a nalaze se u regijama centromera i telomera. Područja s laganim bojenjem obično sadrže aktivne gene, s DNA zapakiranom oko nukleosoma, ali ne dodatno zbijenom.

Slika 9.7 Ove brojke ilustriraju zbijanje eukariotskog kromosoma.


Oštećenje DNK: Tamna strana disanja

Privremene promjene u staničnoj DNK mogu ugroziti cijeli organizam jer mogu dovesti do bolesti opasnih po život poput raka. Istraživači s Ludwig-Maximilians-Universitaet (LMU) u Münchenu sada izvještavaju kako nusprodukti disanja uzrokuju pogrešno spajanje podjedinica u dvostrukoj spirali.

DNK u našim stanicama kontrolira oblik i funkciju svake vrste stanica u našim tijelima. Upute za to kodirane su u linearnom slijedu četiri podjedinice koje se nalaze u DNK, baze adenina (A), citozina (C), gvanina (G) i timina (T). Slučajne promjene u slijedu mogu dovesti do stanične disfunkcije, a mogu rezultirati neograničenom proliferacijom stanica i zloćudnim bolestima. Mutacije mogu izazvati različiti uzročnici. Na primjer, stanično disanje, tj. Redukcija inspiriranog kisika u vodu, koja pokreće staničnu funkciju, također stvara visoko reaktivne vrste kisika koje mogu oštetiti DNA, pri čemu su purinske baze G i A posebno osjetljive na ovu vrstu napada.

"Reaktivne vrste kisika odgovorne su za dvije različite vrste oštećenja DNA jer induciraju stvaranje 8-okso-G i FaPy-G", kaže profesor Thomas Carell s Odjela za kemiju na LMU-u. Godine 2004. rad koji su obavili Carell i njegov tim definirao je kako 8-okso-G stvara mutacije. Međutim, osnova za mutageni učinak FaPy-G ostala je nejasna-do sada. U svojoj posljednjoj publikaciji Carell i njegovi kolege opisuju kako FaPY-G dovodi do pogrešnog spajanja baza u dvostrukoj spirali.

Štetni partner koji zamjenjuje jedan G u jednom nizu dvostruke spirale obično se slaže s C na drugom, tvoreći par G: C. No, kao posljedica oštećenja reaktivnim vrstama kisika, baza gvanina može se pretvoriti u FaPy-G, tako da dobijemo par baza FaPy-G: C. "Sada smo pokazali da tijekom replikacije DNA prije diobe stanica FaPy-G stupa u interakciju s adeninom, što dovodi do stvaranja parova baza FaPy-G: A. Ova zamjena partnera je neobična, budući da nemodificirani gvanin obično ne udružite se s adeninom ", napominje Carell.

FaPy-G se naknadno prepoznaje kao nenormalan i uklanja se pomoću enzima za popravak DNA. Baza koja nedostaje zamijenjena je T - što je uobičajen partner za A. Neto rezultat je da je izvorni par baza G: C pretvoren u par A: T, a bazni niz je prošao potencijalno opasnu mutaciju .

Ovaj je rezultat omogućen činjenicom da je sustavima za kontrolu oštećenja stanice iznenađujuće teško razlikovati normalnu bazu gvanina od njezina aberantnog derivata FaPy-G tijekom replikacije DNA. "To što ovaj nedostatak dovodi do pogrešnog spajanja s adeninom jedan je od glavnih razloga za spontani razvoj tumora", kaže Carell. "Dakle, sa svakim udisajem, rizik od dobivanja raka raste za malo." Daljnji uvidi u razloge zašto FaPy-G često izmiče sustavima detekcije i korekcije stanica mogli bi pomoći u poboljšanju liječenja raka, jer inhibicija procesa popravljanja DNA u tumorskim stanicama povećava njihovu osjetljivost na kemoterapeutske lijekove.

Studiju su podržali bespovratna sredstva DFG -a dodijeljena Centrima za suradnička istraživanja 646 i 749 i Centru za integriranu proteinsku znanost iz Münchena (CIPSM), klaster izvrsnosti.


Proces replikacije DNK

Proteini u replikaciji DNA

Replikacija DNA je visoko regulirana i zahtijeva više proteina za učinkovito funkcioniranje. Većina ovih proteina djeluju kao stabilizatori i enzimi, a enzimi su proteini koji se ponašaju kao katalizatori za stvaranje i ubrzanje biokemijskih reakcija.

Neki od glavnih proteina u replikaciji DNA uključuju sljedeće:

Helikaza: Enzim koji otvara dvostruku spiralu razbijanjem vodikovih veza između komplementarnih parova baza

Jednolančani proteini koji vežu DNA (SSBP): Ovi proteini stabiliziraju pojedine niti DNA kako bi spriječili njihovo ponovno povezivanje.

Topoizomeraza: Budući da odmotavanje DNA helikazom stvara napetost dalje u nizu, ovaj enzim oslobađa napetost tako što pravi rezove u DNK i pridružuje im se prije nego što stigne replikacijska vilica.

Primase: Enzim koji dodaje temeljni premaz (koji je kratki segment ribonukleinske kiseline, poznat kao RNA) gdje će se vezati DNA polimeraza III

DNA polimeraza III: Enzim koji stvara novi lanac DNA dodavanjem nukleotida koji su komplementarni lancu predloška

DNA polimeraza I: Enzim koji zamjenjuje RNA primer s DNA

DNA ligaza: Enzim koji povezuje Okazakijeve fragmente na zaostalom lancu zatvaranjem okosnice šećer-fosfata, stvarajući jedan lanac DNA

Klizna stezaljka: Protein koji drži DNA polimerazu III na mjestu

Mjehurić replikacije

Kad se DNA počne replicirati, nastaje replikacijski mjehurić koji se može vizualno detektirati elektronskom mikroskopijom. Specifičan niz baza- poznat kao podrijetlo replikacije– određuje gdje počinje ovaj mjehurić replikacije. Unutar mjehurića dva oblika slova Y vilice za replikaciju rezultat gdje se DNK aktivno replicira s obje strane regije. Vilice za replikaciju nastaju jer su dvostruki lanci DNA odvojeni helikazom u oba smjera od izvora replikacije. Proteini replikacije DNA pričvršćuju se na vilicu replikacije kako bi ispunili svoje funkcije.

Repliciranje vodećeg niza

Kao što je ranije spomenuto, niti DNK imaju antiparalelnu prirodu, gdje će jedan lanac prolaziti 3’-5 ’, a drugi će se nalaziti suprotno od 5’- 3’. DNA polimeraza može samo sintetizirati novi niti DNK u 5’-3’ smjer. Kako bi DNA polimeraza to učinila, mora pročitati predložak pramen od 3 ′-5 ′. Stoga, repliciranje niti predloška koji vodi 3’-5 ’rezultira sintezom vodeći pramen. Vodeći lanac je novi lanac DNK koji je sintetiziran u jednom, kontinuiranom lancu koji počinje na 5 ’kraju i završava na 3’ kraju.

DNK replikacija vodećeg lanca kada se koristi 3'-5 'šablon nit je sljedeća:

  1. Helikazom se dvostruka spirala DNK otvara u pojedinačne niti. Topoizomeraza ublažava napetost dalje niz dvostruku spiralu.
  2. SSBP -i stabiliziraju pojedinačne DNK lance kako bi se spriječilo njihovo ponovno povezivanje.
  3. Primar se dodaje RNA temeljni premaz u vodeći lanac na besplatnim osnovama.
  4. DNA polimeraza III se veže na temeljni premaz. Klizna stezaljka stabilizira DNA polimerazu III.
  5. DNA polimeraza III pomiče se niz vodeći lanac prema vilici za replikaciju, dodajući baze novom nizu od kraja 5 ’do kraja 3’.

Repliciranje zaostajućeg niza

DNA polimeraza može samo stvarati novi DNK lanci iz 5’-3 ’. Stoga, kada su 5 ′-3 ′ predložak nit se replicira- gdje nova nit mora ići suprotno u smjeru 3 ′-5 ′- nova nit se ne može kontinuirano sintetizirati kao što je to bila vodeća nit. Da bi se prevladao ovaj izazov, potrebni su dodatni koraci za repliciranje 5 ′-3 ′ predloška, ​​pri čemu je ovaj novo sintetizirani niz poznat kao zaostali pramen.

Kako bi se zaostali lanac sintetizirao, DNK je potrebno razgraditi na manje segmente poznate kao Okazaki fragmenti. Zbog ovih više segmenata, zaostala nit je također poznata kao diskontinuirani pramen. Stvaranjem ovih više segmenata, DNA polimeraza III može sintetizirati mali dio novog lanca DNA dalje od vilice za replikaciju u ispravnom smjeru 5 ′-3 ′. Kako se vilica za replikaciju nastavlja niz dvostruku spiralu u smjeru 3 ′ u smjeru predloška, ​​može se stvoriti još jedan Okazaki fragment bliže vilici. DNA polimeraza III ponovno se veže kako bi sintetizirao drugi dio novog lanca DNA dalje od vilice sve dok ne dosegne prethodni već sintetizirani dio. Ti se fragmenti zatim povezuju, što rezultira jedinstvenim lancem DNA. Taj se proces nastavlja cijelom dužinom DNK.

DNK replikacija zaostajućeg lanca kada se koristi 5'-3 'šablon niti je sljedeća:

  1. Helikazom se dvostruka spirala DNK otvara u pojedinačne niti. Topoizomeraza ublažava napetost dalje niz dvostruku spiralu.
  2. SSBP stabilizuju pojedinačne DNK lance.
  3. Primase dodaje RNA primer prema zaostalom lancu.
  4. DNA polimeraza III veže se na temeljni premaz i stvara kratki segment novo sintetizirane DNA iz 5 ′-3 ′, sintetizirajući u suprotnom smjeru replikacijske vilice. Ovo je prvi fragment Okazakija.
  5. Kako helikaza dodatno odmotava dvostruku spiralu, a vilica za replikaciju se pomiče niz lanac, bliže vilici dodaje se još jedan temeljni premaz. DNA polimeraza III se veže za ovaj primer kako bi se sintetizirao drugi Okazakijev fragment u smjeru 5 ′-3 ′ udaljen od replikacijske vilice.
  6. Nakon što DNA polimeraza III dođe do prvog primera Okazakijevog fragmenta, DNA polimeraza I uklanja temeljni premaz i zamjenjuje ih odgovarajućim komplementarnim bazama.
  7. DNA ligaza povezuje segmente DNA zatvarajući okosnicu šećer-fosfata. Dva su segmenta sada spojena u jednu niti.
  8. Taj se postupak ponavlja kako se vilica za replikaciju nastavlja niz DNK.

Koja strana spirale DNK se koristi za opisivanje SNP -ova? - Biologija

Stanice s usne obloge lako se olabave, pa ćete moći prikupiti stanice koje sadrže vašu DNK provlačenjem tekućine oko usta.

Stanice s sluznice usta također se odvajaju kad god žvačete hranu. Što mislite, kako vaše tijelo zamjenjuje stanice koje izlaze iz sluznice usta kada jedete?

Da biste izvukli DNK iz svojih stanica, morat ćete odvojiti DNA od drugih vrsta bioloških molekula u vašim stanicama. Koje su druge glavne vrste velikih bioloških molekula u stanicama?

Koristit ćete iste osnovne korake koje koriste biolozi pri vađenju DNK (npr. Za kloniranje DNK ili izradu otiska DNK prsta). Slijedit ćete ova 3 jednostavna koraka za izdvajanje DNK:

D etergent
E N zymes (omekšivač mesa)
Alkohol

Uzimanje uzorka stanica

Nabavite šalicu sa sportskim pićem. Morat ćete unijeti tisuće svojih obraza u sportsko piće kako biste izvadili dovoljno DNK da vidite. Stoga biste trebali energično pomicati sportsko piće u ustima barem jednu minutu. Zatim ispljunite piće natrag u šalicu.

Dodajte malu količinu deterdženta u epruvetu (oko 0,25 ml ili 1 kap). Sada pažljivo napunite napitak koji sadrži ćelije obraza u epruvetu s deterdžentom dok epruveta nije do pola napunjena.

Zašto dodajem deterdžent?

Da biste izvukli DNK iz stanica obraza, morate otvoriti i stanične i jezgrene membrane. Stanične membrane i jezgrene membrane sastoje se prvenstveno od lipida. Deterdžent za pranje posuđa, kao i svi sapuni, razbija lipide. Zato koristite deterdžente za uklanjanje masti (koje su lipidi) iz prljavog posuđa. Dodavanjem deterdženta u otopinu stanica obraza razbit ćete ćelijske membrane i nuklearne membrane i osloboditi vašu DNK u otopini.

Dodajte malo enzima (omekšivača mesa) u svoju epruvetu. Za miješanje epruvete nježno 20 puta dodirnite dno epruvete. Ostavite smjesu da odstoji najmanje 10 minuta. Dok čekate, naučit ćete o strukturi DNK. Pročitajte ruku pod naslovom "Struktura DNA".

Pipetom polako dodajte hladni alkohol za trljanje u epruvetu i pustite da alkohol teče sa strane epruvete tako da formira sloj na vrhu sapunaste tekućine. Dodajte alkohol dok u epruveti ne bude oko 2 cm alkohola. Alkohol je manje gust od vode pa pluta na vrhu. Ne miješajte i ne udarajte epruvetu 10 minuta. Molekule DNA skupit će se tamo gdje se voda sa sapunom dolje susreće s hladnim alkoholom iznad, a moći ćete vidjeti te nakupine DNK kao bijele niti. Dok čekate da DNK postane vidljiva, naučit ćete o replikaciji DNA.

Zašto dodajem alkohol? Hladni alkohol smanjuje topljivost DNK. Kad se hladni alkohol izlije na vrh otopine, DNK se taloži u alkoholni sloj, dok lipidi i proteini ostaju u otopini.

Kao što možete vidjeti na donjoj slici, DNK se sastoji od dvije niti nukleotida namotanih zajedno u spiralu zvanu dvostruka spirala. Svaki nukleotid sadrži fosfat i molekulu šećera koja se naziva deoksiriboza (što objašnjava zašto je potpuni naziv za DNA deoksiribonukleinska kiselina). Svaki nukleotid također ima jednu od četiri različite dušične baze: adenin (A), timin (T), gvanin (G) i citozin (C).

(Prilagođeno sa slike 9.4 u Biologiji, Johnson i Raven)

Na donjim crtežima prikazan je vrlo mali dio dvostruke spirale DNK iz tri vrlo različita organizma: biljke, sisavca i bakterije. Svaki prikazani lanac DNK sadrži pet nukleotida, svaki sa:

S = pet molekula ugljikovog šećera zvanih deoksiriboza

A = adenin, C = citozin, G = gvanin ili T = timin, baze nukleotida DNA

Možete vidjeti da je fosfat iz jednog nukleotida vezan za šećer u sljedećem nukleotidu kako bi tvorio okosnicu svakog lanca u molekuli DNA. The bases of the nucleotides in each strand of DNA extend toward each other in the center of the DNA double helix molecule. A crucial aspect of DNA structure is the base-pairing rule : A in one strand always pairs with T in the other strand, and G in one strand always pairs with C in the other strand. You will see later that this base-pairing is crucial for the cell to make new copies of each DNA molecule in preparation for cell division.

Which characteristics are similar in the DNA of plants, mammals and bacteria? What is the only characteristic that differs between these segments of DNA from a plant, a mammal and a bacterium? These observations illustrate the similarity of the basic structure of DNA in all living organisms. The genetic differences between plants, mammals and bacteria are due to differences in the sequence of bases in their DNA.

Cells in our body are dividing all the time. For example, cell division in the lining of your mouth provides the replacements for the cells that come off whenever you chew food. Before a cell can divide, the cell must make a copy of all the DNA in each chromosome this process is called DNA replication . Why is DNA replication necessary before each cell division?

As shown in the figure below, the first step in DNA replication is the separation of the two strands of the DNA double helix by the enzyme DNA helicase . After the two strands are separated, another enzyme, DNA polymerase , forms a new matching DNA strand for each of the old DNA strands. DNA polymerase forms the new matching DNA strand by adding nucleotides one at a time and joining each new nucleotide to the previous nucleotide in the growing DNA strand. Each nucleotide added to the new strand of DNA follows the base-pairing rule with the matching nucleotide on the old strand of DNA. The result is two identical DNA double helixes.

(Adapted from Figure 9.9 in Biology by Johnson and Raven)

In the drawing below, the small segment of plant DNA (from page 3) is shown after the two strands of the DNA molecule have been separated by DNA helicase. Your job is to play the role of DNA polymerase and create the new matching strands of DNA to make two pieces of double-stranded DNA in the drawing below. Use the base-pairing rule to determine which nucleotides to add.

During actual DNA replication sometimes mistakes are made and the wrong nucleotide is added to the new strand of DNA. DNA polymerase can “proofread” each new double helix DNA strand for mistakes and backtrack to fix any mistakes it finds. To fix a mistake it finds, DNA polymerase removes the incorrectly paired nucleotide and replaces it with the correct one. If a mistake is made and not found, the mistake can become permanent. Then, any daughter cells will have this same change in the DNA molecule. These changes are called point mutations because they change the genetic code at one point, i.e. one nucleotide. Point mutations can result in significant effects, such as the genetic disease, sickle cell anemia.

Answer the following questions in well thought out complete sentences. DO NOT START A SENTENCE WITH “IT”, “THEY” or “BECAUSE”.

Why is DNA so important in biology?

What is the function of DNA?

Where is DNA found in our bodies?

Compare the sugar-phosphate arrangement in the backbone of the DNA from the plant, the mammal and the bacterium. Are there any differences?

Which bases are present in the DNA of the plant? The mammal? The bacterium?

Are the same bases present in all three cases?

Are the bases in the same order?

Describe the pattern of base pair matching for the two strands in the plant's DNA. In other words, which types of bases are paired together? Does the DNA from the mammal follow the same base-pairing rule as the DNA from the plant? Is base-pairing the same or different in the DNA of the bacterium?

7. Which of the following do you think will contain DNA? Explain your reasoning .

bananas __ concrete __ fossils __ meat __ metal __ spinach __ strawberries __

8. Describe the function of DNA polymerase. Explain why each part of the name DNA polymerase (DNA, polymer, -ase) makes sense.


DNA Polymorphisms: Meaning and Classes | Genetika

In this article we will discuss about the meaning an classes of DNA polymorphisms.

Meaning of DNA Polymorphisms:

Different alleles of a gene produce different phenotypes which can be detected by making crosses between parents with different alleles of two or more genes. Then by determining recombinants in the progeny, a genetic map can be deduced.

These are low resolution genetic maps that contain genes with observable phenotypic effects, all mapped to their respective loci. The position of a specific gene, or locus can be found from the map. However, measurements showed that the chromosomal intervals between the mapped genes would contain vast amounts of DNA.

These intervals could not be mapped by the recombinant progeny method because there were no markers in those intervening regions. It became necessary to find additional differential markers or genetic differences that fall in the gaps. This need was met by exploitation of various polymorphic DNA markers.

A DNA polymorphism is a DNA sequence variation that is not associated with any observable phenotypic variation, and can exist anywhere in the genome, not necessarily in a gene. Polymorphism means one of two or more alternative forms (alleles) of a chromosomal region that either has a different nucleotide sequence, or it has variable numbers of tandemly repeated nucleotides.

Thus, it is a site of heterozygosity for any sequence variation. Many DNA polymorphisms are useful for genetic mapping studies, hence they are referred to as DNA markers. DNA markers can be detected on Southern blot hybridisation or by PCR.

The alleles of DNA markers are co-dominant, that is they are neither dominant nor recessive as observed in alleles of most genes. DNA polymorphisms constitute molecularly defined differences between individual human beings.

Classes of DNA Polymorphisms:

There are some major classes of DNA polymorphisms.

1. Single Nucleotide Polymorphisms:

SNP is a single base pair change, a point mutation, and the site is referred to as SNP locus. SNPs are the most common type of DNA polymorphism, occurring with a frequency of one in 350 base pairs, and accounting for more than 90 per cent of DNA sequence variation. The majority of SNPs are found to be present in the non-coding regions of the genome, known as non-coding SNPs. SNPs in the coding regions, that is within genes, are known as coding SNPs (cSNPs).

Detailed studies of cSNPs in humans indicate that each gene has about four cSNPs, half of which resulting in missense mutations in the encoded protein, and half of which produce silent mutations. Whether a cSNP affects a phenotype, depends on the amino acid that is changed by the polymorphism.

About one-half of missense mutations that are SNPs are estimated to cause genetic disease in humans. A non-coding SNP can also affect gene function if it is located in the promoter region or in the gene regulatory region. A small number of SNPs can create a restriction site, or eliminate an already existing restriction site. SNP-induced alterations in restriction sites are detected by using the restriction enzyme followed by Southern blot analysis or PCR.

An individual SNP locus can be analysed by using the technique of allele-specific oligonucleotide (ASO) hybridisation. The search for one particular SNP locus in humans is a challenge, because this is one base pair that is polymorphic out of the three billion base pairs in the human genome.

In the ASO technique, a short oligonucleotide that is complementary to one SNP allele is synthesised and mixed with the target DNA. Hybridisation is performed under high stringency conditions that would allow only a perfect match between probe and the target DNA. That means, the oligonucleotide will not hybridize with target DNA that has any other SNP allele at that locus. Positive result of hybridisation indicates the SNP locus precisely.

A more recent technique of DNA Microarrays can be used for simultaneous typing of hundreds or thousands of SNPs. Details of this technique used for SNPs and genome wide gene expression are described later in this section.

A small number of SNPs can lead to changes in restriction sites either by creating a restriction site or eliminating one. Such SNPs can be detected by using the restriction enzyme for the site, and detection is done by Southern blot analysis or PCR. The different patterns of restriction sites in different genomes yield fragments of different lengths, called restriction fragment length polymorphisms (RFLPs) described below.

2. Restriction Fragment Length Polymorphisms:

RFLPs are restriction enzyme recognition sites that are present in some genomes and absent in others. Consider an organism heterozygous for an RFLP whose genotype we represent as Rr. This organism is backcrossed with another that is homozygous for the RFLP variation allele (rr). Genomic DNA from the progeny of this cross (Rr x rr gives progeny of which 50% is Rr and 50% is rr) is subjected to restriction enzyme digestion, and fragments separated on Southern blots.

The restriction fragments obtained are hybridised with a probe (a cloned DNA fragment) that will distinguish the various genotypes for an RFLP. The probe DNA is unique because it comes from only one DNA segment of the genome and that overlaps the restriction site. A key point of this technique, therefore, is the use of a specific cloned single-copy DNA probe that is specific for an individual marker locus.

Crosses between the positive RFLP organism with other RFLP bearing organisms would yield parental combinations and re-combinations. From the frequency of recombinants, a detailed RFLP map can be produced. RFLPs were the first DNA markers that were in use for characterisation of plant and animal genomes. They have now been replaced by markers based on variation in the number of short tandem repeats (STRs) described below.

3. Short Tandem Repeats:

STRs are also known as microsatellites and simple sequence repeats (SSRs). A tandem repeat is a sequence that is repeated end to end in the same orientation. STRs are 2 to 6 base pair DNA sequences tandemly repeated a few times.

For example, the sequence TCACATCACATCACATCACATCACA is a five-fold repeat of the sequence TCACA. There are dinucleotide, trinucleotide, four-nucleotide, five-nucleotide and six-nucleotide STRs in the human genome.

Microsatellite analysis can be done using a single-copy DNA to serve as a PCR primer pair specific for each marker locus. In contrast with RFLPs that have only one or two alleles in a population, STRs have a much larger number of alleles which can be detected in a population analysis.

Consequently, STRs have a higher proportion of heterozygotes which makes them more suitable for mapping purposes. Polymorphisms in STRs is common in populations which makes them valuable tools in genetic mapping.

4. Variable Number Tandem Repeats:

VNTRs, also called minisatellite markers, the repeat unit is a little larger than in STRs, from seven to a few tens of base pairs long. The VNTR loci in humans are 1 to 5 kilo-base sequences containing repeat units about 15 to 100 nucleotides long. VNTR loci also show polymorphisms. Due to the greater length of VNTR repeats that makes PCR unsuitable, analysis of VNTRs relies on restriction digestion and Southern blotting.

The entire genomic DNA is cut with a restriction enzyme which cuts on either side of the VNTR locus, but does not have a target site within the VNTR arrays, followed by Southern blotting. The VNTR specific probe against a particular repeat sequence of the VNTR locus, will bind at all locations of the repeat sequence in the genome, resulting in a large number of different sized fragments.

The number of tandem repeats is variable from one individual to the other, therefore Southern blot provides a distinct distinguishing pattern of fragments for a single individual. These patterns are also referred to as DNA fingerprints. The technique finds useful application in identification of individuals and in deciding parentage.

5. Microsatellite Markers:

Variable numbers of di-nucleotides repeated in tandem, called microsatellite markers, are dispersed in the genome. The most common type are CA and the complementary GT repeats. Probes are designed for detection of DNA regions surrounding individual microsatellite repeats by using PCR.

The procedure is explained by taking the example of human DNA as follows. Human genomic DNA is subjected to restriction digestion by an enzyme such as Alu l, that will result in fragments about 400 base pairs in length. The fragments are cloned into a vector and Southern blotting is carried out.

To identify genomic inserts that contain CA/GT di-nucleotides, probes specific for these di-nucleotides are used. Sequence of the positive clones is determined, on the basis of which PCR primers are designed that will hybridise with single-copy DNA sequences flanking the specific tandemly repeated microsatellite sequences. PCR amplification is carried out using these primer pairs and genomic DNA.

Thus, if any size variation exists in the stretch of tandemly repeated microsatellite sequence, it would be detected through gel electrophoresis of the DNAs from different individuals. The size variations may differ among the different individuals, all these variations could be determined. A size variation results in amplification product of a different size and represents a marker allele.

6. Randomly Amplified Polymorphic DNA:

RAPDs are based on random PCR amplification. The procedure is carried out by randomly designing primers for PCR which will amplify several different regions of the genome by chance. Such a primer results in amplification of only those DNA regions that have near them, inverted copies of the primer’s own sequence.

The PCR products consist of DNA bands representing different sizes of the amplified DNA. The set of amplified DNA fragments is called randomly amplified polymorphic DNA (RAPD). Certain bands may be unique for an individual and can serve as DNA markers in mapping analysis.


Gledaj video: Kako izlečiti panični poremečaj? (Kolovoz 2022).